GrainGenes Sequence Report: Kukri_c7257_185
Sequence
Kukri_c7257_185
Contig
1AL_3944931
Species
Triticum aestivum
Probe
Kukri_c7257_185
DNA
GAAATCTGTTTCTTGTATATTGGCCATGATAACTCTTCACCTGACATTCT
Rcaatggcttccagccagggttttcttgttgctgctattcctcgtggata
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Kukri_c7257_185
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
