GrainGenes Sequence Report: 1AL_3976729
Sequence
Kukri_c3804_1340
Contig
1AL_3976729
Species
Triticum aestivum
Probe
Kukri_c3804_1340
DNA
AATGGACAAGCAAAGTCATATGTTGGATAGACCTTGTATTTTGAGCCCAC
RCGATGATGGGGATCAGGGTTGCAACGGTAGTACACAGGATCTCGAAGTG
A

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3976729
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
