GrainGenes Sequence Report: 1AL_3945038
Sequence
Kukri_c13519_1264
Contig
1AL_3945038
Species
Triticum aestivum
Probe
Kukri_c13519_1264
DNA
GATGTCTGAATCTCCTCTGTAGTTTCCGGCAGAGTTGTGACCACGTCATC
RCTACCTTCAGGTGGTGTTGATATCTGAACCTCATCTGTTGTTTCCGGTA
G

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3945038
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
