GrainGenes Sequence Report: Ku_c8422_654
Sequence
Ku_c8422_654
Contig
1AL_3978340
Species
Triticum aestivum
Probe
Ku_c8422_654
DNA
AGATCGACTTTGATAGTGGTTGCATGACATAGTCCAGGGCGCTCAGCACA
RGAGAATTTATCTAGAGCGCTGCAACCTTGTTCATGCAGCCACTGCCGCT
C

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Ku_c8422_654
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
