GrainGenes Sequence Report: 1AL_3959024
Sequence
Ku_c68642_603
Contig
1AL_3959024
Species
Triticum aestivum
Probe
Ku_c68642_603
DNA
TTTCAGGAAAGAACAAAACTATACTTACTGGTTTGATGCCCCAGCAGAAA
RCATGGTGCAGAGGATAACCAAGCACAGGCGCAGGTATCAACCCAATTGT
A

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3959024
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
