GrainGenes Sequence Report: Ku_c56901_416
Sequence
Ku_c56901_416
Contig
1AL_3972590
Species
Triticum aestivum
Probe
Ku_c56901_416
DNA
ACCAATGGCTGAGTATCGAAGCAAAATGTGACTGTTGCATGATGTGCTTG
RCTGTTTATTTGCATACAGCAATATCATCTTTTGGAGATAAAACAGCCGT
A

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Ku_c56901_416
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
