GrainGenes Sequence Report: Ku_c20961_1813
Sequence
Ku_c20961_1813
Contig
1AL_3946588
Species
Triticum aestivum
Probe
Ku_c20961_1813
DNA
CAGGTCCACCAAATGCTTCTTGCCATGAGTCCAGCAGTATCAATATCTTA
Yccttcacttgcatatcgtgcttcttctgaacaatttttaaccatttctt
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Ku_c20961_1813
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
