GrainGenes Sequence Report: JD_c66048_149
Sequence
JD_c66048_149
Contig
1AS_1128350
Species
Triticum aestivum
Probe
JD_c66048_149
DNA
TTGTCTCCGAGCTCCTTCAGTTGTTTCTCAGTCTGGTACATCACAGACTC
YGCCTGGTTCTTGGTGTCAATTGCGTCCCTCTTCTCCTTGTCCTCCGCCG
C

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: JD_c66048_149
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
