GrainGenes Sequence Report: IACX500
Sequence
IACX500
Contig
1AL_3980528
Species
Triticum aestivum
Probe
IACX500
DNA
gcgtgttccttgcatgctgctaattttaatccctattgttcaggagaaga
ttgaacaatcRactgatgttctgaaggcaattattagtcctgttatgaat
gaaggagaagatgcgatgtgg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: IACX500
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
