GrainGenes Sequence Report: GENE-4771_287
Sequence
GENE-4771_287
Contig
1AL_3947753
Species
Triticum aestivum
Probe
GENE-4771_287
DNA
AACCAATGAACATATAGCACCGCATTTCACAATGAGGCAAACAACAATAG
RTYCYGGTGCAGACATAAAGAAATTGCAGAACTATACCTTCAG

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: GENE-4771_287
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
