GrainGenes Sequence Report: 1AL_3959638
Sequence
GENE-0106_172
Contig
1AL_3959638
Species
Triticum aestivum
Probe
GENE-0106_172
DNA
TGTGGAACATAACCCACATATTATTAGATCAAGTATTCGTCAATGCTTGG
RTTTGAGTAATCAAAATATGCCTTGCATAAAGAAGAGGAGGGRGTAT

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3959638
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
