GrainGenes Sequence Report: 1AL_3940914
Sequence
GENE-0035_484
Contig
1AL_3940914
Species
Triticum aestivum
Probe
GENE-0035_484
DNA
TATGTTTAGTAATAGAGAATAAATGGTGACCCAACTTCAAGTTTATGAGT
YAATCYCACCTGAAGCCAGGAAAGTAGAAGGTTCTCATAGCAAGTAT

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3940914
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
