GrainGenes Sequence Report: Excalibur_rep_c113669_264
Sequence
Excalibur_rep_c113669_264
Contig
1AL_3937994
Species
Triticum aestivum
Probe
Excalibur_rep_c113669_264
DNA
AGCCGAGTTCTGCAGTCAGTAGTAAGAATGAAGCAGAGCAACCATCAGAT
RCTTCAAGGTTTAACAACAATGCTTCATGCAGATCAAGGTCTGGTGATGA
T

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Excalibur_rep_c113669_264
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
