GrainGenes Sequence Report: Excalibur_rep_c112293_381
Sequence
Excalibur_rep_c112293_381
Contig
1AL_472932
Species
Triticum aestivum
Probe
Excalibur_rep_c112293_381
DNA
GCACCAGAGAGGCACGCACAGTTAGAACAAGTAAGAGTATGCACTAAGAT
YGGGATAGAGTGCATGGACTTGGACCCAAAGAAGAGACCAGTTGCACAGC
A

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Excalibur_rep_c112293_381
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
