GrainGenes Sequence Report: Excalibur_rep_c104216_671
Sequence
Excalibur_rep_c104216_671
Contig
1AL_3976997
Species
Triticum aestivum
Probe
Excalibur_rep_c104216_671
DNA
GTTGATTTCCTGTCCTGCCTGCTGCAAATCAACCCCAGAAAGAGACCAAC
MGCCAGGGAAGCGTTGCGGCATCGATGGTTTTCACACAAGTATCGTTGAG
C

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Excalibur_rep_c104216_671
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
