GrainGenes Sequence Report: Excalibur_rep_c103025_155
Sequence
Excalibur_rep_c103025_155
Contig
1AL_3954162
Species
Triticum aestivum
Probe
Excalibur_rep_c103025_155
DNA
GTGGACGGGGAACCTTGGGTCCAGCACTCGTGCACGCTGAAGATATCCCA
Ycatggacaggctttcatgctaaagcgagcaatcgagtcgtcgcttggcc
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Excalibur_rep_c103025_155
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
