GrainGenes Sequence Report: Excalibur_c58379_63
Sequence
Excalibur_c58379_63
Contig
1AL_3967057
Species
Triticum aestivum
Probe
Excalibur_c58379_63
DNA
gacttatgaatttggagccatggcccatgtgtaggcaagggcaatgatcc
Mttttactacttgagcggtccaacagagattattgaaggttgtttctgaa
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Excalibur_c58379_63
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
