GrainGenes Sequence Report: Excalibur_c5617_1291
Sequence
Excalibur_c5617_1291
Contig
1AL_3955320
Species
Triticum aestivum
Probe
Excalibur_c5617_1291
DNA
CCACTCCTTCAGGACTTGCCACCCAGCGTGATCCTCCACCACCTATATTC
RCGAGGGCCGGATGAGCTACACTCGCCCTTACAGCGGAACAAGCTGACAC
C

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Excalibur_c5617_1291
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
