GrainGenes Sequence Report: 1AL_3949614
Sequence 
Excalibur_c32809_90 
Contig 
1AL_3949614 
Species 
Triticum aestivum 
Probe 
Excalibur_c32809_90 
DNA 
GCCAAATTAAAGGCTTCTGTCACAGGAGTATTTGGAGAAACAGCAGTCAG
YAACTTATCATTTGGGATTACAATCAGTGTATCAACATTGCTTCTCAAGG
C

 
 
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
 
 
GrainGenes Sequence Report: 1AL_3949614
| 
 | 
 | ||
| 
 | 
 | ||
| 
 | 
 | ||
| 
 | 
 | ||
| 
 | 
 | 
|  
     GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
