GrainGenes Sequence Report: 1AL_3939827
Sequence
Excalibur_c3147_482
Contig
1AL_3939827
Species
Triticum aestivum
Probe
Excalibur_c3147_482
DNA
ATGATGTCAGATCTCACGATCTGCCCATTGCTATTGACAAGAATGTTGAC
Rctctcaaccacatccaagaacacttcattcttcttgtaycgaatcccct
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3939827
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
