GrainGenes Sequence Report: 1AL_3939681
Sequence
Excalibur_c23727_333
Contig
1AL_3939681
Species
Triticum aestivum
Probe
Excalibur_c23727_333
DNA
ACATTTTTTGAAATGTTGTTTGGCTAGGGTGGCGAGATGCAGAGGAGCCC
KAGGTACAGGTGAAGGGAGACGCTGGGTGTCAGGTCGAGCAACTATGGTT
G

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3939681
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
