GrainGenes Sequence Report: Excalibur_c17301_141
Sequence
Excalibur_c17301_141
Contig
1AL_3970298
Species
Triticum aestivum
Probe
Excalibur_c17301_141
DNA
CATTTTGTTCTTTTTACTGCAAGCTAAATAGATCAAGGTGAATAGATGCT
YATGGACTGATTCAAACCGAGRTGGAGATAGATAAGAAGTCAAGCAAGAA
G

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Excalibur_c17301_141
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
