GrainGenes Sequence Report: 1AL_3971952
Sequence
Excalibur_c16976_627
Contig
1AL_3971952
Species
Triticum aestivum
Probe
Excalibur_c16976_627
DNA
TTAGTCTCGTCATCACCAGCTTGATTTTCCGTTCGGTCAATGACCTCATC
RTCTATCTCATCTTCATCTGCTTCTTTGGCGGAATCATCGTCATCATCAT
C

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3971952
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
