GrainGenes Sequence Report: 1AL_3936026
Sequence
Excalibur_c14316_390
Contig
1AL_3936026
Species
Triticum aestivum
Probe
Excalibur_c14316_390
DNA
CCTTTCTTCAATTCATCCCTCAAATACTCCAGCACATAGAAGACTGTGTT
RCTGCTCACATTCCCATAGTTCATCAGGGCCTTTCTACTGATCTTGAGTT
T

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3936026
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
