GrainGenes Sequence Report: Excalibur_c109123_462
Sequence
Excalibur_c109123_462
Contig
1AL_3971952
Species
Triticum aestivum
Probe
Excalibur_c109123_462
DNA
ACAAAGATGGTTTCGAGTTTCTCCCAGAAAACGCCGTTTCCAGAACTCTG
Yatttccatcttctagcttgattctggccgctcgtctgagacttccaagg
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Excalibur_c109123_462
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
