GrainGenes Sequence Report: 1AL_3939032
Sequence
Ex_c86862_89
Contig
1AL_3939032
Species
Triticum aestivum
Probe
Ex_c86862_89
DNA
AATGATATCAGATTCAGCAACAACGCTCTGCCTCGACACGCTCTTGTCGC
YGAACTGCCTCTGGAAGTACCAAAGGAAATCCTTATTGAAGTCGGYGYGT
T

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3939032
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
