GrainGenes Sequence Report: 1AL_3955320
Sequence
Ex_c5617_972
Contig
1AL_3955320
Species
Triticum aestivum
Probe
Ex_c5617_972
DNA
TTCTAACCATTATGGTACATATGGTCTCCGAGCGGGAGGCTGATGATGGC
RGAAGCTTTGACAAGAACTCGTTGCGGAAGTGGACGGCACACTTCTGAAG
C

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3955320
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
