GrainGenes Sequence Report: 1AL_3941425
Sequence
CAP12_c713_141
Contig
1AL_3941425
Species
Triticum aestivum
Probe
CAP12_c713_141
DNA
AAGGAGGTGGTGGACGAGGGGATATACGTGCTGGAGAAGGGAGGGAAGCT
RGTGGTGGAGAGGGGCAAGAAGTTGTTGGAGGAAGGCATTAGCCAGGCCG
C

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3941425
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
