GrainGenes Sequence Report: 1AL_3933735
Sequence
CAP11_c2226_255
Contig
1AL_3933735
Species
Triticum aestivum
Probe
CAP11_c2226_255
DNA
GTAGAGTTGACATGAGTCATCAGGCATAAGAAAAGTCATAGTGGAACTAC
RTCTGTTCTGTCGGTGGTGGCAGTATTTAGATGCATCACTCACCTAGGCA
G

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3933735
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
