GrainGenes Sequence Report: 1AL_3978994
Sequence
BS00066259_51
Contig
1AL_3978994
Species
Triticum aestivum
Probe
BS00066259_51
DNA
AGACAATGCCTTGACAACGAAACGACACACATGCGCCCTTACTGGATCCG
RCCTGTGAAGGCCGATCACGGGTTTTCACCTGAGAAACAGAAGTGTTGAC
G

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3978994
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
