GrainGenes Sequence Report: 1AL_3976389
Sequence
BS00065663_51
Contig
1AL_3976389
Species
Triticum aestivum
Probe
BS00065663_51
DNA
ATTCTTCCGGACCCTTGGTACAGAACTCAAAACCAAAAGCGCCATTGTCA
KGATCCAGTTTAAGAACAGCATGCAAATGAGTCGGCGATGAAGTAACTGT
G

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3976389
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
