GrainGenes Sequence Report: BobWhite_c2783_807
Sequence
BobWhite_c2783_807
Contig
1AL_3945216
Species
Triticum aestivum
Probe
BobWhite_c2783_807
DNA
TCGGAACAGCAATGGCGCTGCTTTGCACGTAAACAGGAGCAGCTTCATGG
YGCTTTCGCTGGGAAGAAGAGATCGTAGAGTAGGCAGGCTGCACAACCAT
G

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: BobWhite_c2783_807
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
