GrainGenes Sequence Report: 1AL_3978548
Sequence
BobWhite_c16234_286
Contig
1AL_3978548
Species
Triticum aestivum
Probe
BobWhite_c16234_286
DNA
CCCTCGCTCTATACAGAGACCGTCTTTGGCTTGGCCCCCATCTTCTTCCA
YGACACGCTGGGCATGATCTGCGCCGTGTCTACCCGGTCCTTGTACTGGA
C

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: 1AL_3978548
|
| ||
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
