GrainGenes Sequence Report: i_12_10206
Sequence
i_12_10206
Species
Hordeum vulgare
Probe
i_12_10206
DNA
tttagacaaacgatagggatttttatttagtcggcaacatctcRgacaaa
ccatactgatRtgctggtacagcagcataataatcaggtgacaacacaac
ttgcatcaagcaagagacggt

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: i_12_10206
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
