GrainGenes Sequence Report: i_11_11246
Sequence
i_11_11246
Species
Hordeum vulgare
Probe
i_11_11246
Remark
E-value: 8e-106, Bitscore: 381.0
DNA Homology
MLOC_58876.3 BLASTN
DNA
tgagcattgcaacatttcatccgtaagaacgtcaacttgctccagggatt
ccatcaccacaaagcaacgtggcaggcctttttatttggttggcggtgca
atccattgttgttgttctccRatgtacatgtgctcatgttgttttgtact
cYMtctgttccatattatttgtcactggggatgctgaactgggtttgccc
agcgacaaatataa

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: i_11_11246
|
| |||
|
| |||
|
| |||
|
| |||
|
| |||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
