GrainGenes Sequence Report: i_11_11054
Sequence
i_11_11054
Species
Hordeum vulgare
Probe
i_11_11054
DNA
ctccgcgtcagggcagaatggggtatttatcaactcatgttttgcccatt
gccagagcgagaggcaggatacatggtactcgagcaactctcctcgtctt
ggcaacaaggtatgcacacaRcaagattcaaatctgtttcttaggcaata
gaaggggaaaactcccggtctcagatcacccaatgcacacaatcaatgaa
catgcggactatttttttccttctcaattacatgtcaattc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: i_11_11054
|
| ||
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
