Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: i_11_10324

[Submit comment/correction]

Sequence	i_11_10324
Species	Hordeum vulgare
Probe	i_11_10324
Remark	E-value: 4e-124, Bitscore: 442.0
DNA Homology	AK355508 BLASTN
DNA	cttgcaaccctacacctgcaggtggatgctgccagggcaatggaggaggg ttaacctgctgccaaagtgatctgccagaaacaaaacaggacaagagcat tccagctgagcagaagcacaRgagctctacgacagagagtgacaaagaaa acggcgccgccagcaagaagggatgcatgaagatttgccggatgcccacc tggtttgagacctgggacaggtctgacacctacaccactct

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.