GrainGenes Sequence Report: BE398631
Sequence
BE398631
Contig
Ta.27384.1.S1_at
External Databases
Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index
TC308909
wEST map position
BE398631
NCBI UniGene
Ta.27384
DB Remark
Locus Source: Triticum aestivum (bread wheat) UniGene title 'Clone wdk3c.pk006.c16:fis, full insert mRNA sequence'
Keyword
EST
Species
Triticum aestivum
Cultivar
Cheyenne
Chromosome
3AL 3BL 7AL
Clone Library
ITEC WHE Wheat Endosperm Library
Tissue
endosperm
Developmental Stage
5-30 days post anthesis
Data Source
genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title
WHE0023.C09F990702 ITEC WHE Wheat Endosperm Library Triticum aestivum cDNA clone WHE0023.C09, mRNA sequence.
Clone
WHE0023.C09
Probe
WHE0023.C09F990702
Remark
DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Anderson OA; USDA ARS WRRC; 800 Buchanan Street, Albany, CA 94710-1105 USA; Tel: 510 559 5773; Fax: 510 559 5818; Email: oandersn@pw.usda.gov; International Triticeae EST Cooperative (ITEC); http: Note: Vector: Lambda ZAPII; Wheat Endosperm Library constructed in Lambda ZAPII with 8-mer adapter.
DNA Homology
Ta.27384.1.S1_at 545 WHE2AFFY
DNA
ctgcaggaatcggcacgagttttttttttttttttttagtaagcccaacc
attttattctgtcatcttgttccaggaggatccatggagttgccgtcacg
gggaagggcacacggcggccgtgctatgaacaagacgctgctactagtag
tattagagatgaacaaggggattaaacacaagtagacagatgacatatat
aaagtcttcgtccaaagtctcctctgttccatcaaacaccagcggacgct
ttggtgtcacctccgtcgtccaggcgtccatggtgtttccgctggtcctc
acgctgggaccgtctccgagtcgatgc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: BE398631
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
