GrainGenes Sequence Report: BE213979

HV_CEb0001N01f Hordeum vulgare seedling green leaf EST library HVcDNA0005 (Blumeria challenged) Hordeum vulgare subsp. vulgare cDNA clone HV_CEb0001N01f, mRNA sequence.

Strain

lab_host SOLR

vulgare

Clone

HV_CEb0001N01f

Probe

[Bcl543ct1003cn3930]

{SpCl-154}

Remark

DB_xref: taxon:112509

Feature: source: mol_type = 'mRNA';

Locus Comment: On Jul 3, 2000 this sequence version replaced gi:13263887.; Contact: Wing RA; Clemson University Genomics Institute; Clemson University; 100 Jordan Hall, Clemson, SC 29634, USA; Tel: 864 656 7288; Fax: 864 656 4293; Email: rwing@clemson.edu; Total hq bases = 494; Seq primer: AATTAACCCTCACTAAAGGG; High quality sequence stop: 675.

Note: Vector: lambdaZAP; Site_1: EcoR1; Site_2: Xho1; C.I. 16151 (Mla6) plants were greenhouse grown in the R Wise lab at Iowa State University, Ames, IA; 7 day old green seedlings were challenged with isolate 5874 (AvrMla6 ) of Blumeria graminis f. sp. hordei, and leaves were harvested 20 and 24 hr post-inoculation and snap frozen; uninoculated leaves were harvested 20 hr post-inoculation (Wei, Wise). In the TJ Close lab at the University of California, Riverside, total RNA was prepared from each sample pool, equal quantities of all three RNA pools were combined, poly(A) RNA was purified from the mixture, one primary unamplified cDNA library was made, and 1 million pfu were in vivo excised to give pBluescript SK(-) cDNA phagemids (Choi, Close). Phagemids were plated and picked at the Clemson University Genomics Institute (CUGI) (Begum , Palmer, Frisch, Atkins and Wing). Plasmid DNA preparations, DNA sequencing and sequence analysis were performed at CUGI (Wing, Yu, Frisch, Henry, Simmons, Oates , Rambo, Main). The sequence has been trimmed to remove vector sequence and contains a minimum of 100 bases of phred value 20 or above. For more details on library preparation and sequence analysis see http:

Note: Vector: lambdaZAP; Site_1: EcoR1; Site_2: Xho1; C.I. 16151 (Mla6) plants were greenhouse grown in the R Wise lab at Iowa State University, Ames, IA; 7 day old green seedlings were challenged with isolate 5874 (AvrMla6) of Blumeria graminis f. sp. hordei, and leaves were harvested 20 and 24 hr post-inoculation and snap frozen; uninoculated leaves were harvested 20 hr post-inoculation (Wei, Wise). In the TJ Close lab at the University of California, Riverside, total RNA was prepared from each sample pool, equal quantities of all three RNA pools were combined, poly(A) RNA was purified from the mixture, one primary unamplified cDNA library was made, and 1 million pfu were in vivo excised to give pBluescript SK(-) cDNA phagemids (Choi, Close). Phagemids were plated and picked at the Clemson University Genomics Institute (CUGI) (Begum, Palmer, Frisch, Atkins and Wing). Plasmid DNA preparations, DNA sequencing and sequence analysis were performed at CUGI (Wing, Yu, Frisch, Henry, Simmons, Oates, Rambo, Main). The sequence has been trimmed to remove vector sequence and contains a minimum of 100 bases of phred value 20 or above. For more details on library preparation and sequence analysis see http:

DNA

tttagccgccgccgccgccgccgccgcccccgccccccgcagagagaagc
gagcgacagcgaggtcgacgccatggtgcagcgcctgacgtaccggaagc
ggcacagctacgccaccaagtctaaccagaccagggttgtcaaaacccca
ggagggaggcttgtgtaccagtacacgaagaagagggcgagcgggccgaa
atgtccggtcaccggcaagaagatccaggggatacctcatctaaggccta
ctgagtacaaaaggtccagattatccaggaacaggagaacagtgaaccgt
ccttatggtggtgttctatctggtcaggctgttcgggagaggatcatccg
tgctttccttgtggaagagcaaaagattgtgaagaaggttctgaagatcc
agaagaccaaggagaagcagccatcaaagtgaaatggctgaggctttttt
ttggaggacagatggtgatgagtgttcagtcaaaagcctgcgtagtatgc
taagctcgtggttactgaattaaactagagatttccgtccatttttcttt
gttcgagggtgggatctgatctcattacccgtatgctattactnntgtgt
tgacggtttgacctgagtacttgggtatattacagntnttggataccctn
tgcaaaaaaaaaaaaaaaaaaaaaaaaaaaa


GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.