Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: tplb0045c05_547

[Submit comment/correction]

Sequence	tplb0045c05_547
Contig	7BL_6724606
Probe	tplb0045c05_547
DNA Homology	7BL_6724606 Best IWGSC match 117 3e-24 URGI_Best IWGSC_N
BLAST, e-value	3e-24 7BL_6724606 Best IWGSC match
DNA	ggctacttcctgtggtcagcgtcggcctacggcaccgggctcctgatcac Rtacgtggcgctgaacctgatggacgggcacgggcagccggcgctgctct a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.