Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: tplb0021f14_1700

[Submit comment/correction]

Sequence	tplb0021f14_1700
Contig	7BL_6742751
Probe	tplb0021f14_1700
DNA Homology	7BL_6742751 Best IWGSC match 178 1.00053e-42 URGI_Best IWGSC_N
BLAST, e-value	1.00053e-42 7BL_6742751 Best IWGSC match
DNA	cttggatgctccgcaaactccctcacggtcttctccagcgtcgtgaccct Rtccgcacaaggaggcctgcctggagcagcagcacctacacgcacccttt g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.