Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 7AL_3384095

[Submit comment/correction]

Sequence	Excalibur_c287_622
Contig	7AL_3384095
Probe	Excalibur_c287_622
DNA Homology	7AL_3384095 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 7AL_3384095 Best IWGSC match
DNA	tgtccagtccatacctgtcagcggcagcaaggagatgctgagccatcacc Rtcaccgccgcctcctgctgtccgaattctggcatggtgtcggtatagat g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.