Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GENE-0293_65

[Submit comment/correction]

Sequence	GENE-0293_65
Contig	7BS_3159588
Probe	GENE-0293_65
DNA Homology	7BS_3159588 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 7BS_3159588 Best IWGSC match
DNA	acttattgttgttatgcctgttttcgatgtagctgggatggtctggagcg Ragacttgcctggtgtggaaacgctcaaggagaacattgctgcgtatttc a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.