Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: JD_c8873_489

[Submit comment/correction]

Sequence	JD_c8873_489
Contig	7DS_3891948
Probe	JD_c8873_489
DNA Homology	7DS_3891948 Best IWGSC match 174 1.99993e-41 URGI_Best IWGSC_N
BLAST, e-value	1.99993e-41 7DS_3891948 Best IWGSC match
DNA	tcagggaggccctagaggggcacatgaggaaatcggctatacgagytatt Mtcggtcgagatctgccttgggcaccagctcatcaggccaggaggtggat g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.