Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 7DS_3968760

[Submit comment/correction]

Sequence	Excalibur_rep_c68220_195
Contig	7DS_3968760
Probe	Excalibur_rep_c68220_195
DNA Homology	7DS_3968760 Best IWGSC match 172 7.00005e-41 URGI_Best IWGSC_N
BLAST, e-value	7.00005e-41 7DS_3968760 Best IWGSC match
DNA	tcgatcgcctccgctatcggagtgaccagcagcgcgaacttggtgaacgg Rttgatcagcgtggtgtagatggcgatgctggagctcaggttcctcgatg g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.