Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_BE498209A_Ta_2_1

[Submit comment/correction]

Sequence	wsnp_BE498209A_Ta_2_1
Contig	7AS_4081208
Probe	wsnp_BE498209A_Ta_2_1
DNA Homology	7AS_4081208 Best IWGSC match 178 1.99965e-42 URGI_Best IWGSC_N
BLAST, e-value	1.99965e-42 7AS_4081208 Best IWGSC match
DNA	GGTGGCCAACTCTTTCCTGCTTTCCTGTGAGAAGTAAGAAACACCAAAGC ATCCATGTAARTTAATAATCCTATGCAAAATTGGCCCAATTCAATTCAAA ACGCATGT

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.