Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 6DS_2074435

[Submit comment/correction]

Sequence	Ex_c350_344
Contig	6DS_2074435
Probe	Ex_c350_344
DNA Homology	6DS_2074435 Best IWGSC match 174 1.99993e-41 URGI_Best IWGSC_N
BLAST, e-value	1.99993e-41 6DS_2074435 Best IWGSC match
DNA	tagatccacagcatcgcgctgaagagcgccaccacatacgggaccgactg Raacccctgcgtcgacttgctccggtagatccggtagaacgttggcagtg g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.