Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 5AL_2548774

[Submit comment/correction]

Sequence	RFL_Contig6072_710
Contig	4DL_14306789 5AL_2548774
Species	Triticum aestivum
Probe	RFL_Contig6072_710
DNA Homology	4DL_14306789 Best IWGSC match 167 3e-39 URGI_Best IWGSC_N
BLAST, e-value	3e-39 4DL_14306789 Best IWGSC match
DNA	gcgctatctggctgaagggaaaatgcggcggccttccattgtatttcctg Mtgctgctaggagaatggatactctcaatgatctattggcagcaagtgat c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.