Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Ex_c20946_574

[Submit comment/correction]

Sequence	Ex_c20946_574
Contig	6BL_4383636
Probe	Ex_c20946_574
DNA Homology	6BL_4383636 Best IWGSC match 135 9e-30 URGI_Best IWGSC_N
BLAST, e-value	9e-30 6BL_4383636 Best IWGSC match
DNA	tcatcatcccactcagattcttcaggatatttcatagatgaatcaccaag Raaagcgctgccagaaggcacgatttcttctaccctactttctgcagcta t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.