Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_c10614_157

[Submit comment/correction]

Sequence	BobWhite_c10614_157
Contig	6BS_3026159
Probe	BobWhite_c10614_157
DNA Homology	6BS_3026159 Best IWGSC match 117 3e-24 URGI_Best IWGSC_N
BLAST, e-value	3e-24 6BS_3026159 Best IWGSC match
DNA	catcgatcttccttcccacctcagctaggctccgcaatcgatcgaatcgg Ragagggggatgaagccttcagtggccgccgccgggatcgccggggagat g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.